View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10730_low_4 (Length: 248)
Name: NF10730_low_4
Description: NF10730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10730_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 12827925 - 12827705
Alignment:
| Q |
17 |
gttggaggatggatccatgggttctctaaatcttgtggtcgtgtttctaaccttcttgctgagctctatgccatcctcaatgggcttccgttggcttggg |
116 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12827925 |
gttggaggatggatccatggtttctctgaatcttgtggtcgtgtttctaaccttcttgttgagctctatgccatcctcaatgggcttcagttggcttggg |
12827826 |
T |
|
| Q |
117 |
atttaggatttagaatcattactttggaatctgattataaatcggctcttgatcttattctcgataacgacacgacttatcatcctcatgccattgttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12827825 |
atttaggatttagaatcattactttggaacctgattataaatcagctcttgatcttattctcgataacgacacgacttatcatcctcatgccattgttct |
12827726 |
T |
|
| Q |
217 |
gggtcggattcgtaccttcat |
237 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
12827725 |
gggtcggattcgtaccctcat |
12827705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University