View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10730_low_5 (Length: 232)
Name: NF10730_low_5
Description: NF10730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10730_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 33860292 - 33860089
Alignment:
| Q |
1 |
attgtttaagaatgcttgtctctgtcctaaaatttgtttcgcgcacaatatgagtcctcccctcacaactagattttctaaatataaaagatctaggaat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33860292 |
attgtttaagaatgcttgtctccgtcctaaaatttgtttcgcgcacaatatgagtcctcccctcacaactagattttctaaatataaaagatctaggaat |
33860193 |
T |
|
| Q |
101 |
tgaaccagtggtcacttgattaaggaatttgagtaccttagcactcggaccaaccatacgttgttggttcatggtttgtatttagactcatataacctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||| |||||||||||||||||||||| | ||||||| ||| |
|
|
| T |
33860192 |
tgaaccagtggtcacttgattaaggaatttgagtaccttagcactcgg-ctaaccatatgttggtggttcatggtttgtatttagattaatataacttac |
33860094 |
T |
|
| Q |
201 |
cagaa |
205 |
Q |
| |
|
||||| |
|
|
| T |
33860093 |
cagaa |
33860089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University