View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10730_low_7 (Length: 209)
Name: NF10730_low_7
Description: NF10730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10730_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 20624191 - 20623993
Alignment:
| Q |
1 |
actatctaaaactgaaataatggatgatgaagccaaaattttaatcagaaaaatgtattgtagaaattctatccaaaaaggaattttnnnnnnnntgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
20624191 |
actatctaaaactgaaataatggatgatgaagccaaaattttaatcagaaaaatgtattgtagaaattctatccaaaaaggaattataaaaaaaatgtga |
20624092 |
T |
|
| Q |
101 |
aatcaaaatgtcactatatttgaaaattggtgcagtcactttaatagcaactaaatggcttttcattgaataagttttctaactctcgaccctttgctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20624091 |
aatcaaaatgtcactatatttgaaaattggtgcagtcactttaatagcaaataaatggcttttcgttgaataagttttctaactctcgaccctttgctt |
20623993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University