View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10730_low_8 (Length: 201)
Name: NF10730_low_8
Description: NF10730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10730_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 186
Target Start/End: Original strand, 12829171 - 12829343
Alignment:
| Q |
14 |
aagaagaaatgctaatgattgaaaactagactgctatggttttgtttatagcctgttgtgcaccattgcctctttccttaacccgacaccattatcctca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12829171 |
aagaagaaatgctaatgattgaaaactaggctgctatggttttgtttatagcctgttgtgcaccattgcctttttccttaacccgacaccattatcctca |
12829270 |
T |
 |
| Q |
114 |
cagttgaatactttcgtttatctgattgtgcaggatttaatgacactattgtcttaatcaataatgtgaaatg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12829271 |
cagttgaatactttcgtttatctgattgtgcaggatttaatgacactattgtcttaatcaataatgtgaaatg |
12829343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 51 - 186
Target Start/End: Original strand, 12824136 - 12824272
Alignment:
| Q |
51 |
ggttttgtttatagcctgttgtgcaccattgcctctttccttaacccgacaccattatcctcacagttgaatactttcgtttatctgattgtgcaggatt |
150 |
Q |
| |
|
||||||||| ||| |||| | | ||||||| ||||| |||||||||||||||| |||||||||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
12824136 |
ggttttgttcataacctgatttacaccatttcctctctccttaacccgacaccgttatcctcacggttgaatacttttgtttttctgattgtgcaggatt |
12824235 |
T |
 |
| Q |
151 |
taatgacacta-ttgtcttaatcaataatgtgaaatg |
186 |
Q |
| |
|
| ||||||||| ||| ||| ||| ||||||||||||| |
|
|
| T |
12824236 |
tgatgacactatttggcttgatccataatgtgaaatg |
12824272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University