View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10731_high_6 (Length: 234)
Name: NF10731_high_6
Description: NF10731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10731_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 23 - 222
Target Start/End: Complemental strand, 27646304 - 27646102
Alignment:
| Q |
23 |
agatgaaactcatatccttctaccaacgttgaattgcattatctgtaataatattgttcgacttttatttcatctgtataccacaaaaacttttaataac |
122 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27646304 |
agatgaaactcatacccttctaccaacattgaattgcattatctgtaataatattgttcgacttttatttcatctgtataccacaaaaacttttaataac |
27646205 |
T |
 |
| Q |
123 |
agtca---nnnnnnnnctataaaccagtatcatctgcacgcaactgcagggactacttccattgagctgtatgttctcctcagtcccaacatattccttt |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
27646204 |
agtcattttttttcttctataaaccagtatcatctgcacgcaactgcagagactactttcattgagctgtatgttcccctcagtcccaacgtattccttt |
27646105 |
T |
 |
| Q |
220 |
gct |
222 |
Q |
| |
|
||| |
|
|
| T |
27646104 |
gct |
27646102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University