View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10731_low_13 (Length: 227)
Name: NF10731_low_13
Description: NF10731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10731_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 17230647 - 17230851
Alignment:
| Q |
18 |
taaattttactcaattgcgatctgccataaaaaatgggctttgcctattatgcttggaaattgctgttaagaccccctaaaaatctgaaaatgctcatat |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17230647 |
taaattctactcaattgcgatctgccataaaaaatgggctttgcctattatgcttggaaattgctgttaagaccccctaaaaatctgaaaatgctcatat |
17230746 |
T |
|
| Q |
118 |
ccacaaccatctgtagttgctctgggaagttaagttctgatacttctacctctattaacatgaactaactttgtcttcttttcgatctttggcaattcct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17230747 |
ccacaaccatctgtagttgctctgggaagttaagttctgatacttctacctctattaacatgaactaactttgtcttcttttcgatctttggcaattctt |
17230846 |
T |
|
| Q |
218 |
gtgtt |
222 |
Q |
| |
|
||||| |
|
|
| T |
17230847 |
gtgtt |
17230851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University