View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10731_low_6 (Length: 290)

Name: NF10731_low_6
Description: NF10731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10731_low_6
NF10731_low_6
[»] chr7 (1 HSPs)
chr7 (216-273)||(4499382-4499439)


Alignment Details
Target: chr7 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 216 - 273
Target Start/End: Original strand, 4499382 - 4499439
Alignment:
216 gcaattatgttgcaagttatggtgatgaaaaaatggggtgctgttcataattggtttg 273  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
4499382 gcaattatgttgcaagttattgtgatgaaaaaatggggtgctgttcataattggtttg 4499439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University