View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10732_high_4 (Length: 248)
Name: NF10732_high_4
Description: NF10732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10732_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 68 - 177
Target Start/End: Original strand, 41911072 - 41911181
Alignment:
| Q |
68 |
caatagatgatgattgaaaatttaaaattaggttaggggtacttttgttaatttgaggtgtaacnnnnnnnngttggggtgtgattagaaatcgtagttt |
167 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41911072 |
caatagatgatgattgaaaatttaatattaggttaggggtacttttgttaatttggggtgtaacaaaaaaaagttggggtgtgattagaaatcatagttt |
41911171 |
T |
|
| Q |
168 |
tttctaatac |
177 |
Q |
| |
|
|||||||||| |
|
|
| T |
41911172 |
tttctaatac |
41911181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University