View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10732_low_11 (Length: 205)
Name: NF10732_low_11
Description: NF10732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10732_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 27 - 189
Target Start/End: Original strand, 34270209 - 34270371
Alignment:
| Q |
27 |
tgatcaacccctgcaaagcttgacatgtggagaatttagtacatggcctccccgtaatctccacatcatatgatgccacgttggtgcaaccttctgtaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34270209 |
tgatcaacccctgcaaagcttgacatgtggagaatttagtacacggcctccccgtaatctccacatcatatgatgccacgttggtgcaaccttctgtaca |
34270308 |
T |
|
| Q |
127 |
tatatgtttcaaacattgtacagcttcacttaattgcacaaacaacttttgttcttccctatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34270309 |
tatatgtttcaaacattgtacagcttcacttaattgcacaaacaacttttgttcttccctatg |
34270371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University