View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10732_low_3 (Length: 363)
Name: NF10732_low_3
Description: NF10732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10732_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 356
Target Start/End: Original strand, 34270348 - 34270702
Alignment:
| Q |
1 |
aaacaacttttgttcttccctatgtttatctcctctcttcttcctctgtttcacccaatcaccaacttattnnnnnnnnnnnnnnnnnnncataattact |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34270348 |
aaacaacttttgttcttccctatgtttctctcctctcttcttcctctgtttcacccaatcaccaacttattaaaaaaatataaataaat-cataattact |
34270446 |
T |
|
| Q |
101 |
ggattttaataaaatgattattatttaccgattcttgttctttgttgagacagataatttcaacttcgagccaagggtcatgtttatgcaataatttcca |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34270447 |
gaattttaataaaatgattattatttaccgattcttgttctttgttgagacggataaggtcaacttcgagacaagggtcatgtttatgcaataatttcca |
34270546 |
T |
|
| Q |
201 |
cccctctgtttctttcaccgcttcgaaattattggtaactaacttgacacacctgaagtagagatttggtgcatcacaaagcttagccaagtgcaacacg |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34270547 |
cccctctgtttctttcaccgcttcaaaattattggtaactaacttgacacacttgaagtagagatttggtgcatcacaaagcttagccaagtgcaacacg |
34270646 |
T |
|
| Q |
301 |
tccaccacattccctgtggtcatgaattggatcaagtcaacagtgcacctttgctt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34270647 |
tccaccacattccctgtggtcatgaattggatcaagtcaacagtgcacctttgctt |
34270702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University