View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10732_low_7 (Length: 248)

Name: NF10732_low_7
Description: NF10732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10732_low_7
NF10732_low_7
[»] chr1 (1 HSPs)
chr1 (68-177)||(41911072-41911181)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 68 - 177
Target Start/End: Original strand, 41911072 - 41911181
Alignment:
68 caatagatgatgattgaaaatttaaaattaggttaggggtacttttgttaatttgaggtgtaacnnnnnnnngttggggtgtgattagaaatcgtagttt 167  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||        ||||||||||||||||||||| ||||||    
41911072 caatagatgatgattgaaaatttaatattaggttaggggtacttttgttaatttggggtgtaacaaaaaaaagttggggtgtgattagaaatcatagttt 41911171  T
168 tttctaatac 177  Q
    ||||||||||    
41911172 tttctaatac 41911181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University