View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10732_low_8 (Length: 243)
Name: NF10732_low_8
Description: NF10732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10732_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 17 - 171
Target Start/End: Complemental strand, 12422992 - 12422842
Alignment:
| Q |
17 |
aatatcaaatcaaatgaagctttcgatcttcccttcttaaagtgtgtatgtgattttccattatttggtgtgatgactttgcttgtgagatgttgagcat |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12422992 |
aatatcaaatcaaatgaagcttttgatcttcccttcttaaagtgtgtatgtgattttccattatttggtgtgatgact----ttgtgagatgttgagcat |
12422897 |
T |
 |
| Q |
117 |
gggagatgataaaagagaaaacgtcttgcaaatgaatgtcttttagatgcttttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12422896 |
gggagatgataaaagagaaaacgtcttgctaatgaatgtcttttagatgcttttt |
12422842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University