View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10733_low_2 (Length: 277)
Name: NF10733_low_2
Description: NF10733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10733_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 13 - 258
Target Start/End: Complemental strand, 40117087 - 40116857
Alignment:
| Q |
13 |
gagcagagatgaagacgacgagtacgagcagcaagcaattttggaacaagtcttcggccactcctccgattcctcctccgattcctccttcgattcagat |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40117087 |
gagcaaagatgaagacgacgagtacgagcagcaagcaattttggaacaagtcttcggccactcctcc------tcctccgattcctccttcgattcagat |
40116994 |
T |
|
| Q |
113 |
tctgataattgctattcgaatctaaagaaatgggaacgcatagaaaaagtaaaagggttatggatagtaagaaacttcatatcatcccacaaacaatccc |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40116993 |
tctgataattgctattcgaa---------atgggaacgcatagaaaaagtaaaagggttatggatagtaagaaacttcctatcatcccacaaacaatccc |
40116903 |
T |
|
| Q |
213 |
gcttactctcatcaatcgcatctgaaaattggttcacacaaccatc |
258 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40116902 |
gcttactctcatcaatcgcttctgaaaattggttcacacaaccatc |
40116857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University