View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10733_low_5 (Length: 257)
Name: NF10733_low_5
Description: NF10733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10733_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 2 - 246
Target Start/End: Original strand, 45398088 - 45398332
Alignment:
| Q |
2 |
ttgttttccagccattcttcaaccttttgagaaaataatatactactcatgttggcagtgtcaagcttctctttaattattttattttcttcattcagag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398088 |
ttgttttccagccattcttcaaccttttgagaaaataatatactactcatgttggcagtgtcaagcttctctttaattattttattttcttcattcagag |
45398187 |
T |
|
| Q |
102 |
agatgatggttttctgtgtatcttgcaatgcatcctgtaactcgtcaatcaatctactcattctactattttcttctagagtttcatcctgaatcttctt |
201 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398188 |
agatgatggttttatgtgcatcttgcaatgcatcctgtaactcgtcaatcaatctactcattctactattttcttctagagtttcatcctgaatcttctt |
45398287 |
T |
|
| Q |
202 |
ggcctcgaataaattctgttccaaggccatcatttcgagcttcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398288 |
ggcctcgaataaattctgttccaaggccatcatttcgagcttcat |
45398332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University