View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10734_low_3 (Length: 257)
Name: NF10734_low_3
Description: NF10734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10734_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 436992 - 436762
Alignment:
| Q |
18 |
tgataaagtaatgaagaatagtattttctgagcacaaaggaagcatttgttgctgttgatggaaaactgaaagctgcagttacttctttccatcttctct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436992 |
tgataaagtaatgaagaatagtattttctgagcacaaaggaagcatttgttgctgttgatggaaaactgaaagctgcagttacttctttccatcttctct |
436893 |
T |
|
| Q |
118 |
ctttcataagctgtaacacaaattgctataaagataaggatattatgcaatcaccaaaaattatatatgtaattctttccgatctttgtacaaatcaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436892 |
ctttcataagctgtaacacaaattgctataaagataaggatattatgcaatcaccaaaaattatatatgtaattctttccgatctttgtacaaatcaata |
436793 |
T |
|
| Q |
218 |
gggatgattaatatgatataaactttcatct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
436792 |
gggatgattaatatgatataaactttcatct |
436762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 24 - 121
Target Start/End: Original strand, 52517754 - 52517851
Alignment:
| Q |
24 |
agtaatgaagaatagtattttctgagcacaaaggaagcatttgttgctgttgatggaaaactgaaagctgcagttacttctttccatcttctctcttt |
121 |
Q |
| |
|
|||||||||| |||||| || | |||||||| ||||||||||| || |||||||||||| ||||| || |||||||||||||||| |||| ||||| |
|
|
| T |
52517754 |
agtaatgaagtatagtacttccgcagcacaaaagaagcatttgtagccgttgatggaaaattgaaaactaaagttacttctttccattttctatcttt |
52517851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University