View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10735_low_3 (Length: 289)
Name: NF10735_low_3
Description: NF10735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10735_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 40948218 - 40948488
Alignment:
| Q |
1 |
agacggtgatggtgatgatagtgatgacacgtgaaggtttcaacaatggcatgcggtcatatatttcaccacgattgtattgtaaaatggctaaaaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40948218 |
agacggtgatggtgatgatagtgatgacacgtgaaggtttcaacaatggcatgcggtcat----ttcaccacgattgtattgtaaaatggctacaaacaa |
40948313 |
T |
 |
| Q |
101 |
tttatgctatgcctacttgaatatttattgagattattttcagtttttggttcaatattgtgtatcaatgtttaatactacttaactagtctacgattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40948314 |
tttatgctatgcctacttgaatatttattgagattattttcagtttttggttcaatattgtgtatcaatgtttagtactacttaactagtctacgattgt |
40948413 |
T |
 |
| Q |
201 |
atgtagtttttgaagttcttttagcttaatgttgattttagagtcattttgataaatcattattatgtatgtatt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40948414 |
atgtagtttttgaagttcttttagcttaatgttgattttagagtcattttgataaatcattattatgtatgtatt |
40948488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 40634605 - 40634645
Alignment:
| Q |
29 |
acgtgaaggtttcaacaatggcatgcggtcatatatttcac |
69 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
40634605 |
acgtgaaggtgtcaacaatgccatgcggtcatatatttcac |
40634645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University