View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10735_low_5 (Length: 267)
Name: NF10735_low_5
Description: NF10735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10735_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 226
Target Start/End: Complemental strand, 18819949 - 18819726
Alignment:
| Q |
3 |
cataggttctcagttggagaaagaacgcaactttctcttcaggttcaaaataaatccttttgaggcttcatcctacagtagggttggatgcagaaggcac |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18819949 |
cataggttctcagttggagaaagaacacaactttctcttcaggttcaaaataaatccttttgaggcttcatcctacagtagggttggatgcagaaggcac |
18819850 |
T |
|
| Q |
103 |
ttcaccaatatttgaagcatgatttggggttttagattgctcacgagccatacaatattcttcttgaagtgcttcgagttcattccattcaactccagct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18819849 |
ttcaccaatatttgaagcatgatttggggttgtagattgctcacgagccatacaatattcttcttgaagtgcttcgagttcattccattcaactccagct |
18819750 |
T |
|
| Q |
203 |
gtaaatatatcaaggaaattacaa |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18819749 |
gtaaatatatcaaggaaattacaa |
18819726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University