View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10736_high_10 (Length: 240)
Name: NF10736_high_10
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10736_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 28847189 - 28847413
Alignment:
| Q |
2 |
taaattttaattttaatcatatttggaaatatatgacctacaagaaattggctatcgataca-----ttgcctgctggcaacaaataacacaaaacacca |
96 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
28847189 |
taaatcttaattttaatcatatttggaaatatatgacctacaagaaattggctatcgatacacctcattgcctgctggcaacaaataacacaa--cacca |
28847286 |
T |
 |
| Q |
97 |
gccaaagtaaaccaatttctgcacatttgaactgctaatgttgtcactgaaatgatcgtacaaaagtaccactttgtcaaaaaacttcaaattagtcaac |
196 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28847287 |
gccaaagtaaacgaatttctgcacatttgaactgctaatgttgtcactgaaatgatcgtacaaaagtaccactttgtcaaaaaacttcaaattagtcaac |
28847386 |
T |
 |
| Q |
197 |
aaaaataaagctaaggcaatttagttg |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28847387 |
aaaaataaagctaaggcaatttagttg |
28847413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University