View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10736_high_13 (Length: 233)

Name: NF10736_high_13
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10736_high_13
NF10736_high_13
[»] chr8 (1 HSPs)
chr8 (108-218)||(36938431-36938541)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 108 - 218
Target Start/End: Original strand, 36938431 - 36938541
Alignment:
108 gatgaggcgtgaggccattgcgccgcccattactccgattccgatccatccgattcgggttgtggaggtggtgattgggtttgggtatttgcttcccatg 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
36938431 gatgaggcgtgaggccattgcgccgcccattactccgattccgatccatccgattcgggttgtggaggtggtgattgggtttgggtatttgcgtcccatg 36938530  T
208 ctgccgtaagt 218  Q
    |||||||||||    
36938531 ctgccgtaagt 36938541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University