View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10736_high_6 (Length: 262)
Name: NF10736_high_6
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10736_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 33437534 - 33437777
Alignment:
| Q |
1 |
gggtgcaataagggccttaaaattcacatcagatggaaagtttttggccatggctgagccagcagactttgtccatatttttgattcacattctggttat |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33437534 |
gggtgcaataaggtccttaaaattcacatcagatggaaagtttttggccatggctgagccagcagactttgtccatatttttgattcacattctggttat |
33437633 |
T |
|
| Q |
101 |
gtacaaagtcaagagattgatatatttggtgaaattgctggtttatcttttagccctgacacagaggctctgtttgtcggtgtggctgaccgaacctacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33437634 |
gtacaaagtcaagagattgatatatttggtgaaattgctggtttatcttttagccctgacacagaggctctgtttgtcggtgtggctgaccgaacctacg |
33437733 |
T |
|
| Q |
201 |
gtagcttgttagagttcaccagaaagcattattatcagtatctg |
244 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33437734 |
gtagcttgttagagttcacgagaaagcattattatcagtatctg |
33437777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University