View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10736_low_17 (Length: 234)
Name: NF10736_low_17
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10736_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 36450205 - 36450411
Alignment:
| Q |
19 |
ggtaagagttttcatggtggatggttgaattgacgatgaatttggcaaaattatggtggtcaatgattttgtttaaggtccaacatgtattcttttgcca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36450205 |
ggtaagagttttcatggtggatggttgaattgacgatgagtttggcaaaattatggtggtcaatgattttgtttaaggtccaacatgtattcttttgcca |
36450304 |
T |
|
| Q |
119 |
aaatcatggtggcacattgtgattctgccgaacttactctcaatcttatgttcaatcccaaacgtacacataaatagatggctaggagatcaaaattttc |
218 |
Q |
| |
|
|||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36450305 |
aaatcacgatggcacattgtgattctgccaaacttactctcaatcttatgttcaatcccaaacgtacacataaatagatggctaggagatcaaaattttc |
36450404 |
T |
|
| Q |
219 |
ttcttct |
225 |
Q |
| |
|
|| |||| |
|
|
| T |
36450405 |
tttttct |
36450411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University