View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10736_low_18 (Length: 233)
Name: NF10736_low_18
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10736_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 108 - 218
Target Start/End: Original strand, 36938431 - 36938541
Alignment:
| Q |
108 |
gatgaggcgtgaggccattgcgccgcccattactccgattccgatccatccgattcgggttgtggaggtggtgattgggtttgggtatttgcttcccatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36938431 |
gatgaggcgtgaggccattgcgccgcccattactccgattccgatccatccgattcgggttgtggaggtggtgattgggtttgggtatttgcgtcccatg |
36938530 |
T |
 |
| Q |
208 |
ctgccgtaagt |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
36938531 |
ctgccgtaagt |
36938541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University