View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10736_low_21 (Length: 220)
Name: NF10736_low_21
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10736_low_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 7 - 220
Target Start/End: Original strand, 34120280 - 34120490
Alignment:
| Q |
7 |
aacccatgtttatctaaacgtccaaatgcacattactttcacgatgagagtgatagatacggacttcctaaaaaattgattgaattgtttgcagttgtat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120280 |
aacccatgtttatctaaacgtccaaatgcacattactttcacgatgagagtgatagatacggacttcctaaaaaattgattgaattgtttgcagttgtat |
34120379 |
T |
 |
| Q |
107 |
tacaagtgttttctctnnnnnnntatatattgatataaactaatccaattaagtgtagtttggattgatctgttcattcgatctttgcctacatgtaagt |
206 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34120380 |
tacaagtgttttctctaaaaa---aaatattgatataaactaatccaattaagtttagtttggattgatctgttcattcgatctttgcctacatgtaagt |
34120476 |
T |
 |
| Q |
207 |
ttatatttatatat |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34120477 |
ttatatttatatat |
34120490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University