View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10736_low_26 (Length: 208)
Name: NF10736_low_26
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10736_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 23617893 - 23618058
Alignment:
| Q |
1 |
aacgtccatccataaaacaattccttttgcgggctttggaaacatagaaattgaaatat----tttaatttgtgcatgccacttattttattggtggaaa |
96 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||| || | |||||||||||||||||||||||||||||||| |
|
|
| T |
23617893 |
aacgtccatccataaaacaattctttttgcaggctttgaaaacatagaaattgaaatatatgtttcagtttgtgcatgccacttattttattggtggaaa |
23617992 |
T |
 |
| Q |
97 |
tggaaaagaacaactagcaaagaaatggagaaaatttgagaaataacataacacttgatccttattgaca |
166 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23617993 |
tggaaaagaacaactagc----aaatggagaaaatttgagaacaaacataacacttgatccttattgaca |
23618058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University