View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_high_6 (Length: 240)
Name: NF10737_high_6
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 6894783 - 6894998
Alignment:
| Q |
19 |
gtggaaacattaaagccatggtcttggagcttattggtatttagaaaacgtccgccagagcctctagctctcttcaatgcatgcagatggcgcgactcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6894783 |
gtggaaacattaaagccatggtcttggagcttattggtatttagaaaacgcccgccagagcctctagctctcttcaatgcatgcagatggcgcgactcat |
6894882 |
T |
 |
| Q |
119 |
gtagatatggctgcaagacaatatccaaaatgttattaagagaaatttcccttggagaaaaggaaacgaaaatgtacacttactttccgatttttgacga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6894883 |
gtagatatggctgcaagacaatatccaaaatgttattaagagaaatttcccttagagaaaaggaaacgaaaatgtacacttactttccgatttttgacga |
6894982 |
T |
 |
| Q |
219 |
gtttgttctctgcttc |
234 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
6894983 |
gtttgttctgtgcttc |
6894998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 142
Target Start/End: Complemental strand, 42656404 - 42656302
Alignment:
| Q |
40 |
tcttggagcttattggtatttagaaaacgtccgccagagcctctagctctcttcaatgcatgcagatggcgcgactcatgtagatatggctgcaagacaa |
139 |
Q |
| |
|
||||||||||| || | ||| |||||||| || || | |||||||||||||| |||||||| | ||| || ||||| || ||||||||||||| |||| |
|
|
| T |
42656404 |
tcttggagctttttagcattgagaaaacggccaccggctcctctagctctctttaatgcatgtacatgtcgggactcgtgaagatatggctgcagaacaa |
42656305 |
T |
 |
| Q |
140 |
tat |
142 |
Q |
| |
|
||| |
|
|
| T |
42656304 |
tat |
42656302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University