View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_high_8 (Length: 207)
Name: NF10737_high_8
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_high_8 |
 |  |
|
| [»] scaffold1519 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1519 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: scaffold1519
Description:
Target: scaffold1519; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 7 - 144
Target Start/End: Complemental strand, 1423 - 1286
Alignment:
| Q |
7 |
gaagcaaaggacaggagtttagacatgccatttccatgtctacatactacctctgaagtcttacgggtgtggtcccttcttcaggaacttcaggttctga |
106 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1423 |
gaagcaaagtacaagagtttagacatgccatttccatgtctacatactacctctgaagtcttacgggtgcggtcccttcttcaggaacttcaggttctga |
1324 |
T |
 |
| Q |
107 |
ttaccattcttgtggtttattgtgacagtcatggtatt |
144 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1323 |
ttaccagtcctgtggtttattgtgacagtcatggtatt |
1286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1519; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 141 - 207
Target Start/End: Complemental strand, 482 - 416
Alignment:
| Q |
141 |
tattgttgccttaagtcataatcctgtccttcattcaaggacaaaacataggtaactgaacattttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
482 |
tattgttgccttaagtcataatcctgtccttcattcatggacaaaacataggtaactgaacattttc |
416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University