View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_low_14 (Length: 299)
Name: NF10737_low_14
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 40863050 - 40863312
Alignment:
| Q |
18 |
gttggttcatgcaatggattgaaatctgaaaaaataatagcctcttcacatagtaatttgaaattatatcttggttatgatctttccactgaaacttgta |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863050 |
gttggttcatgcaatggattgaaat-tgaaaaaataatagcctcttcacatagtaatttgaaattatatcttggttatgatctttccactgaaacttgta |
40863148 |
T |
|
| Q |
118 |
agctggtagcattcggtgtggagttggacggtaggaaa---aatgcaacaagcaagtgtggtgtaagttttcagtttcggggataatatattcaacactt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863149 |
agctggtagcattcggtgtggagttggacggtaggaaaaataatgcaacaagcaagtgtggtgaaagttttcagtttcggggataatatattcaacactt |
40863248 |
T |
|
| Q |
215 |
acccgtgtctctactttttaggcttaattatgttcgcaacaatggtgtttattttagtgatact |
278 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40863249 |
actcgtgtctctactttttaggcttaattatgttcgcaacaatggtgtttattttagtggtact |
40863312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University