View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_low_16 (Length: 267)
Name: NF10737_low_16
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 45549715 - 45549962
Alignment:
| Q |
11 |
agcttcttgttcatttcttctactcaacatttgttcaatcttttcaggctttattttcttgctgtccatgaatttatgatcttttagtgtttgtgttcca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549715 |
agcttcttgttcatttcttctactcaacatttgttcaatcttttcaggctttattttcttgctgtccatgaatttatgatcttttagtgtttgtgttcca |
45549814 |
T |
 |
| Q |
111 |
ttagcacgttgaaattcttgatatcttggggaggacttctttcttttaataatttcttttactttctcattagatgcgactatatctagatcaccacgtg |
210 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549815 |
ttagctcgttgaaattcttgatatcttggggaggacttctttcttttaataatttcttttactttctcattagatgcgactatatctagatcaccacgtg |
45549914 |
T |
 |
| Q |
211 |
atatcttgaacggtgtgggttggtttatgaatgattgcctcttcttct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45549915 |
atatcttgaacggtgtgggttggtttatgaatgattgcttcttcttct |
45549962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University