View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_low_23 (Length: 228)
Name: NF10737_low_23
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 44720353 - 44720132
Alignment:
| Q |
1 |
cttacttttggcttcttcttggtagctgatattagtttgaaacaaagaagataaaagtaaatactgttagctacttgaacatatctgtttcatccattct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44720353 |
cttacttttggcttcttcttggtagttgatattagtttgaaacaaagaagataaaagtaaatactgttagctacttgaacatatctgtttcatccattct |
44720254 |
T |
|
| Q |
101 |
tttatttttatgacagttaattacaacatgggaaagcatctcactatgtgaacgcttaaccatgtcagccttctgcaggtaacattgctgcttttaatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44720253 |
tttatttttatgacagttaattacaacatgggaaagcatctgactatgtgaacgtttaaccatgtcagccttctgtaggtaacattgctgcttttaatgc |
44720154 |
T |
|
| Q |
201 |
tttaaatgaaaattcagatatc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44720153 |
tttaaatgaaaattcagatatc |
44720132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 5 - 214
Target Start/End: Original strand, 43169632 - 43169858
Alignment:
| Q |
5 |
cttttggcttcttcttggtagctgatattagtttgaaacaaagaagataaaagtaaatactgttagctacttgaacatatctgtttcatccattctttta |
104 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||| || || |||| | || |||||||||||| |||||||||| |
|
|
| T |
43169632 |
ctttttgcttcttattggtagctgatattagtttgaaa--aagaagataaaagtaaattttg--agatactcgcacgtatctgtttcattcattctttta |
43169727 |
T |
|
| Q |
105 |
tttttatgacagtta-------------attacaacatgggaaagcatctcactatgtgaacgcttaaccatgtcagccttctgcaggtaa--------c |
183 |
Q |
| |
|
||||||||||||||| ||| |||| || |||||||| |||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
43169728 |
tttttatgacagttataatatgggtgtgatttcaaccaggcaaagcatcacactatgtgaacgcttaaccgtgtcagccttctgcaggtaaaattaacgc |
43169827 |
T |
|
| Q |
184 |
attgctgcttttaatgctttaaatgaaaatt |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |
|
|
| T |
43169828 |
attgctgtttttaatgctttaaatgaaaatt |
43169858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University