View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_low_25 (Length: 227)
Name: NF10737_low_25
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 20479602 - 20479426
Alignment:
| Q |
1 |
tagtttattggaattgaagttagggtttgctacaaccgaagatataaattggaaacgaaacccttatttagcataaaacaagatagataactctcaaaac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479602 |
tagtttattggaattgaaggtagggtttgctacaaccgaagatataaattggaaacgaaacccttatttagcataaaacaagatagataactctcaaaac |
20479503 |
T |
|
| Q |
101 |
cctagctagcgatcttctcttctttccatagttccactctcgcaatcgcatcacacataatgggaaatcataagaag |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20479502 |
cctagctagcgatcttctcttctttccatagttccactctcgcaatcgcatcgcacataatgggaaatcataagaag |
20479426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University