View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10737_low_27 (Length: 222)
Name: NF10737_low_27
Description: NF10737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10737_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 51826787 - 51826976
Alignment:
| Q |
15 |
cataggaaattatcaaagaggtaatcttttttctaacaggtccaacgatgcatggaaggagcactccaatctcaagtggaagaacaactttgctctaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
51826787 |
cataggaaattatcaaagaggtaatcttttttctaacacgtccaacgatgcacggaaggagcactctaatcgcaagtggaaaaacaactttgctctaaat |
51826886 |
T |
|
| Q |
115 |
cccactcaagggccgccacaaaatccataacaaacaaagatggctcaacaggaagaaatgttgaaacaactcatgaaggccacccgtatt |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
51826887 |
cccactcaagggccaccacaaaatccataacaaacaaagatggctcaacaggaagaaatgttgaaacaactcatgaagtccacccatatt |
51826976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University