View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10738_low_11 (Length: 250)
Name: NF10738_low_11
Description: NF10738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10738_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 11 - 142
Target Start/End: Complemental strand, 43261674 - 43261543
Alignment:
| Q |
11 |
cagagatacacattaattcagggtgccatagacccaaaagaaagttggagattaaaagcagtgaaataaattaccatctttgtccatcatacaaagtaca |
110 |
Q |
| |
|
|||| ||||||| ||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43261674 |
cagaaatacacactaagtcaaggtgccatagacccaaaagaaagttggagattaatagcagtgaaataaattaccatctttgtccacaatacaaagtaca |
43261575 |
T |
 |
| Q |
111 |
atatttagaaagataagatgaataggcaaaga |
142 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
43261574 |
atatttacaaagataagatgaataggcaaaga |
43261543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 173 - 250
Target Start/End: Complemental strand, 46575098 - 46575021
Alignment:
| Q |
173 |
gatacaactctgccaacaagattcagaaaaactactaaatatcaaaaatcacgaagaactgaagtcaaactttttatc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
46575098 |
gatacaactctgccaacaagattcagaaaaacttctaaatatcagaaactacgaagaactgaagtcaaactttttatc |
46575021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University