View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10738_low_12 (Length: 241)

Name: NF10738_low_12
Description: NF10738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10738_low_12
NF10738_low_12
[»] chr5 (1 HSPs)
chr5 (1-181)||(4269455-4269635)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 4269455 - 4269635
Alignment:
1 tataaattcaaaattgggacaaacaatgtgagatcttttgttaagagaaatcttgcaaatacttaaataagaagaagacggaaaacatttgatatattag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
4269455 tataaattcaaaattgggacaaacaatgtgagatcttttgttaagagaaatcttgcaaatacataaataagaagaagacggaaaacatttgatatattag 4269554  T
101 aatacggaattgaatttataatatttctcttattcgtactctatgtgtgaatttgtctcttttttttatgaatgggaaagc 181  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
4269555 aatatggaattgaatttataatatttctcttattcgtactctatgtgtgaatttctctcttttttttatgaatgggaaagc 4269635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University