View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10738_low_14 (Length: 232)
Name: NF10738_low_14
Description: NF10738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10738_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 12052162 - 12052362
Alignment:
| Q |
11 |
agcaaaggaaagcctcttcagaatcatctatggttgcatagaagaacattgtttgacgttttgatttagcatggtgtctgtttgatttaacatggtgcct |
110 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12052162 |
agcaaaggaaagcttcttcagaatc---tatggttgcatagaagaacattgtttgacgttttgatttagcatggtgtctgtttgatttaacatggtgcct |
12052258 |
T |
|
| Q |
111 |
tgctgaaggtaatgtattttaaactatatttattcattcagttaaaagagtcgagataagtttcatttcattgtttagattgatagtacaaagttgtatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12052259 |
tgctgaaggtaatgtattttaaactatatttattcattcagttaaaagagtcgagataagtttcatttcattgtttagattgatagtacaaagttgtatt |
12052358 |
T |
|
| Q |
211 |
ggac |
214 |
Q |
| |
|
|||| |
|
|
| T |
12052359 |
ggac |
12052362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University