View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10738_low_5 (Length: 339)
Name: NF10738_low_5
Description: NF10738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10738_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 7e-77; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 10 - 163
Target Start/End: Original strand, 38038530 - 38038683
Alignment:
| Q |
10 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgttgtttgaggaagtaaattcgaagtcggatacttgtatttcatgattattgacaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038530 |
tgttctgttctgttcttatgctgttaattgtgcaattgatacatgctgtttgagggagtaaattcgaagtcggatacttgtatttcatgattattgacaa |
38038629 |
T |
|
| Q |
110 |
gaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038630 |
gaaatgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta |
38038683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 196 - 326
Target Start/End: Original strand, 38038680 - 38038810
Alignment:
| Q |
196 |
cttaattagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatgattttactagcttattgggt |
295 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38038680 |
cttaactagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatcattttactagcttattgggt |
38038779 |
T |
|
| Q |
296 |
attatggtataaggtaccacttttttgatgt |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38038780 |
attatggtataaggtaccacttttttgatgt |
38038810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 38025340 - 38025404
Alignment:
| Q |
258 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
322 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38025340 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38025404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 322
Target Start/End: Original strand, 38030739 - 38030803
Alignment:
| Q |
258 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
322 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38030739 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38030803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University