View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10738_low_8 (Length: 264)

Name: NF10738_low_8
Description: NF10738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10738_low_8
NF10738_low_8
[»] chr8 (2 HSPs)
chr8 (88-246)||(28298115-28298273)
chr8 (12-50)||(28298311-28298349)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 88 - 246
Target Start/End: Complemental strand, 28298273 - 28298115
Alignment:
88 tattgatatatttgttttctacaaatttatattttatctctgttcaactcatcannnnnnngagaaaatctatgttcaaaacatcaatgttacaagtttt 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||       ||||||||||||||||||||||||||||||| |||||||    
28298273 tattgatatatttgttttctacaaatttatattttatctctgttcaacacatcatttttttgagaaaatctatgttcaaaacatcaatgttataagtttt 28298174  T
188 tagaaaaatcacaagctgtaattacagtcttacccatgtaacttggataggggggaatg 246  Q
    |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
28298173 tagaaaaatcacaagctgcaattacagtcttacccatgtaacttgcataggggggaatg 28298115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 12 - 50
Target Start/End: Complemental strand, 28298349 - 28298311
Alignment:
12 acagaccaacatgttacaatttgtagccggccggcacat 50  Q
    |||||||||||||||||||||||||||||||||||||||    
28298349 acagaccaacatgttacaatttgtagccggccggcacat 28298311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University