View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_high_26 (Length: 243)
Name: NF10739_high_26
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 112 - 225
Target Start/End: Complemental strand, 8871735 - 8871622
Alignment:
| Q |
112 |
gataaataaatcaataatgagctgtatatatgggtgatacagattgaagaagattgtaagctaggcacagcaaatgacatagcagaagcagttcatcaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8871735 |
gataaataaatcaataatgagctgtatatatgggtgatacagattgaagaagactgtaagctaggcacagcaaatgatatagcagaagcagttcatcaaa |
8871636 |
T |
 |
| Q |
212 |
tattcagctacatc |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8871635 |
tattcagctacatc |
8871622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University