View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_low_14 (Length: 331)
Name: NF10739_low_14
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 20 - 318
Target Start/End: Complemental strand, 41884965 - 41884667
Alignment:
| Q |
20 |
gcacaaatgtcgataaatgctcatgtataattaaacaccttatctaatcttaattgaatgaatacacctttgactttaatttttcacaagcgaaattgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41884965 |
gcacaaatgtcgataaatgctcatgtataattaaacaccttatctaatcttaattgaatgaatacacctttgactttaatttttcacaagcgaaattgat |
41884866 |
T |
|
| Q |
120 |
tcatccatcaaaattcttcatgtcaaacttcatagcaaaacttgacaatgcaattgtagagataatgatccatgtcattgaaaatatgagtcacctcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41884865 |
tcatccatcaaaattcttcatgtcaaacttcatagcaaaacttgacaatgtaattgtagagataatgatccatgtcattgaaaatatgagtcacctcttt |
41884766 |
T |
|
| Q |
220 |
tataaattcaatgttaagccctttaacagtcgatcagaaactatccccctcaaacttgaacctaacaaactccactctcttactctatgtcttttattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41884765 |
tataaattcaatgttaagccctttaacagtcgatcagaaactatccccctcaaaattgaacctaacaaactccactctcttactctatgtcttttattt |
41884667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University