View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_low_22 (Length: 271)
Name: NF10739_low_22
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 49040158 - 49040396
Alignment:
| Q |
18 |
agccatctcgttccacattacaccgctttggtaacacttcaagtagttcactttggtatgagttagcatacgtagaggccaagggtagagtttcaaaggg |
117 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040158 |
agccatcttgttccacattacatcgctttggtaacacttcaagtagttcactttggtatgagttagcatacgtagaggccaagggtagagtttcaaaggg |
49040257 |
T |
|
| Q |
118 |
ggatagggtgtggcagattgattgcatttggggctggttttaaatgtaacagtgccgtatggagggcatgtcgtgacataccacttctacatgactggac |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040258 |
ggatagggtgtggcagatt----gcatttggggcaggttttaaatgtaacagtgccgtatggagggcatgtcgtgacataccacttctacatgactggac |
49040353 |
T |
|
| Q |
218 |
gggaaatccatgggatgactctgttaacaactaccctattcat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040354 |
gggaaatccatgggatgactctgttaacaactaccctattcat |
49040396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 19671813 - 19671772
Alignment:
| Q |
46 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
87 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19671813 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19671772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 87
Target Start/End: Complemental strand, 19742933 - 19742892
Alignment:
| Q |
46 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
87 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19742933 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19742892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 87
Target Start/End: Original strand, 19797155 - 19797196
Alignment:
| Q |
46 |
tggtaacacttcaagtagttcactttggtatgagttagcata |
87 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
19797155 |
tggtaacacttcaagtagttctgtttggtatgagttggcata |
19797196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University