View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_low_33 (Length: 250)
Name: NF10739_low_33
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 41537808 - 41538038
Alignment:
| Q |
1 |
tcttaagatgaaatttcaaccactatgttactttgagaaaaatataaaagcactcaactatttctatgctaaaaacatcatctttaaatagttttgatgc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41537808 |
tcttaaaatgaaatttcaaccactatgttactttgagaaaaatataaaagcactcaactatttctatgctaaaaacatcatctttaaatagttttgatgc |
41537907 |
T |
 |
| Q |
101 |
agttaactttttacaccaattaaatattttaaaatcacatttgattggtgttttttgaccgcgtaaaactgtttaagtgaatagtagttatactagcatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41537908 |
agttaactttttacaccaattaaatattttaaaattacatttgattggtgttttttgaccgcgtaaaactgtttaagtgaatagtagttatactagcatt |
41538007 |
T |
 |
| Q |
201 |
ttcgtattaagctttccccaccttatttttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41538008 |
ttcgtattaagctttccccaccttatttttt |
41538038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University