View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_low_45 (Length: 229)
Name: NF10739_low_45
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 211
Target Start/End: Original strand, 26474052 - 26474250
Alignment:
| Q |
13 |
cagagattatggcaggtaaatcacgttgcagctgcagcaattcaatgttactgcatggcaaatgaattgaattactctattaagttgtagtactatacga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26474052 |
cagacattatggcaggtaaatcacgttgcagctgcagcaattcaatgttactgcatggcaaatgaattgaattactctattaagttgtagtactatacga |
26474151 |
T |
 |
| Q |
113 |
cttaggaataggaataccttattattacaaaataaggacaacaaaataatcattttgtcggaattttgcttggtggttggtttagcttagatcactatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26474152 |
cttaggaataggaataccttattattacaaaataaggacaacaaaataatcattttgtcggaattttgcttggtggttggtttagcttagatcactatc |
26474250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University