View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_low_49 (Length: 225)
Name: NF10739_low_49
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 49 - 209
Target Start/End: Original strand, 52001661 - 52001821
Alignment:
| Q |
49 |
ccctaactttactttcttatcatgtctcacaattttgcttgagcctcccacatgcatactcttaaggggcctggaaatggccacaactaggccctctcat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52001661 |
ccctaactttactttcttatcatgtctcacaattttgcttgagcctcccacatgcatactcttaaggggcctggaaatggccacaactaggccctctcat |
52001760 |
T |
|
| Q |
149 |
ccagaaataatattcatgttcacaaagacatgacatgaacgttttatgattggtaattgtg |
209 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52001761 |
ccaaaaataatattcatgttcacaaagacatgacatgaacgttttatgattggtaattgtg |
52001821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University