View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10739_low_54 (Length: 205)
Name: NF10739_low_54
Description: NF10739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10739_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 11 - 184
Target Start/End: Original strand, 41813890 - 41814063
Alignment:
| Q |
11 |
cataggggggttgatgtttggcaacaggcggctaccaacaagaaacatgaaaggcaaaagtagcgtctttaaatcagtgcatgtattagtgaattatgtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41813890 |
cataggggggttgatgtttggcaacaggcggctaccaacaagaaacatgaaaggcaaaagtagcgtctttaaatcagtgcatgtattagtgaattatgtt |
41813989 |
T |
|
| Q |
111 |
ggtagagacaattggaagtttatgaaatgtgtatgagcagagataaataattgaattatatggttccatttaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41813990 |
ggtagagacaattggaagtttatgaaatgtgtatgagcagagataaataattgaattatatggttccatttaag |
41814063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University