View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_high_10 (Length: 284)
Name: NF10740_high_10
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 38999646 - 38999396
Alignment:
| Q |
18 |
atctattaaacttgtaattgatttagcaacaatgatttagcacatattctttaatttatgcacaaataaccaatgtcatccaatgtggaagttgatgata |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999646 |
atctattaaacttgtaattgatttaacaacaatgatttagcacat-ttctttaatttatgcacaaataaccaatgtcatccaatgtggaagttgatgata |
38999548 |
T |
|
| Q |
118 |
ctagttttatttctcaacattataattttctcagctttttgttcctttatcaatgtgatctagagcaaaaatgtaaattcacagctggattgtaatttca |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999547 |
ctagttttatttctcaacgttataattttctcagctttttgttcctttatcaatgtgatctagagcaaaaatgtaaattcacagctggattgtaatttca |
38999448 |
T |
|
| Q |
218 |
cagccatcaaacatgtaaattaaaaggggaaacataatagtaatctctgctc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
38999447 |
cagccatcaaacatgtaaattaaaaggggaaaaataatagtaatctcggctc |
38999396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University