View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_high_11 (Length: 282)
Name: NF10740_high_11
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 258
Target Start/End: Original strand, 13917177 - 13917433
Alignment:
| Q |
6 |
agaagcataggaagattcattgtctaccgtttggtcaatttggttccataaaaatgagatcatttt-gaagggaagaaggtgacttgcaaggacgtggtt |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13917177 |
agaagaataggaagattcattgtctaccgtttggtcaatttggttccataaaaatgagatcatttttgaagggaagaaggtgacttgcaaggacgtggtt |
13917276 |
T |
 |
| Q |
105 |
aaacctata--aaagttatttcatggggtttgatatctctcaagggagagaaaagggctatagttttcccaattgacattcaaatta-tttatgttgtct |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
13917277 |
aaacctatataaaagttatttcatggggtttgatatctctcaagggagagaaaagggctatagtttttccaattgacattcaaattattttatgttgtct |
13917376 |
T |
 |
| Q |
202 |
tttggattcgctttaattaagtttatatactctttgcattatgtatgagttagagta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13917377 |
tttggattcgctttaattaagtttatatactctttgcattatgtatgagttagagta |
13917433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University