View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_high_27 (Length: 227)
Name: NF10740_high_27
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 52688416 - 52688197
Alignment:
| Q |
1 |
ctcacctttgtgttgcgggtaacgtcccaatacgatcaaaatatcattcaaagatgaatactgacgtgtgatatccccaatgggagtctcaatattcctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52688416 |
ctcacctttgtgttgcgggtaacgtcccaatacgatcaaaatatcattcaaaggtgaatattgacgtgtgatatccccaatgggagtctcaatattcctc |
52688317 |
T |
 |
| Q |
101 |
tagtgccatataaaatggcagttattcatccataatggcaaccactaagtggcatcatcataaccaaataattacacacatttaaaatgacttaagtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52688316 |
tagtgccatataaaatggcagttattcatccataatggcaaccactaagtggcatcatcataaccaaataattacacacatttaaaatgacttaagtttt |
52688217 |
T |
 |
| Q |
201 |
aaattcgataacctttgctt |
220 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
52688216 |
aaattcgctaacctttgctt |
52688197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University