View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_high_9 (Length: 318)
Name: NF10740_high_9
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 20 - 310
Target Start/End: Original strand, 49732410 - 49732700
Alignment:
| Q |
20 |
atatgattatgttatatattgtatccgttgatgagatgagaccatttattcaatggtaatgcagcatgattaattatgggatcgccaaaaatgatgcacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49732410 |
atatgattatgttatatattgtatccgttgatgagatgagaccatttattcaatggtaatgcagcatgattaattatgggatcgccaaaaatgatgcacc |
49732509 |
T |
 |
| Q |
120 |
agtttgctattttgcagtaagttttggctatgtgactgtttcccttctt----ctagctagctagcgacgaaatgaaaggatgtgtcgttgtatagtctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49732510 |
agtttgctattttgcagtaagttttggctatgtgactgtttcccttcttctagctagctagctagcgacgaaatgaaaggatgtgtcgttgtatagtctt |
49732609 |
T |
 |
| Q |
216 |
ttgcggcgttgtttaatagggtgacctgacacaaacaagcaatgaccctgaaaatcagattaggttcggggatgtgtatttatttgtttcttctc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49732610 |
ttgcggcgttgtttaatagggtgacctgac----acaagcaatgaccctgaaaatcagattaggttcggggacgtgtatttatttgtttcttctc |
49732700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University