View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_low_18 (Length: 253)
Name: NF10740_low_18
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_low_18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 4643520 - 4643279
Alignment:
| Q |
12 |
agcataggtattcatgtcagcatttagcaactaagagacaagtttacattcataaatttgtagtatatgataagaaccaatagtatgcatcttactttca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643520 |
agcataggtattcatgtcagcatttagcaactaagagacaagtttacattcataaatttgtagtatatgataagaaccaatagtatgcatcttactttca |
4643421 |
T |
|
| Q |
112 |
tcttcttccgattagctttattctcacacggatcgttaaaaacccttgttttattcagagatgtattgccaccagcgtcgccgagaaaatttttattaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643420 |
tcttcttccgattagctttattctcacacggatcgttaaaaacccttgttttattcagagatgtattgccaccagcgtcgccgagaaaatttttattaag |
4643321 |
T |
|
| Q |
212 |
tggattcaatgaagcaccactctcacccttggaacccttggc |
253 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4643320 |
tggattcaatgaagcaccaccctcacccttggaacccttggc |
4643279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 130
Target Start/End: Original strand, 40802232 - 40802260
Alignment:
| Q |
102 |
cttactttcatcttcttccgattagcttt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40802232 |
cttactttcatcttcttccgattagcttt |
40802260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University