View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_low_26 (Length: 240)
Name: NF10740_low_26
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 58 - 240
Target Start/End: Original strand, 9500171 - 9500352
Alignment:
| Q |
58 |
cttatatatgttgtgtagtttgtacttggtagacctgtcgtattgatttaacattatgccttcaattttgtttcttcaatttttgagcatttatatgcat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9500171 |
cttatatatgttgtgtagtttgtacttggtagccctgtcgtattgatttaacattacgccttcaaatttttttcttcaatttttgagcatttatatgcat |
9500270 |
T |
 |
| Q |
158 |
gtattataagttactcgagttgtctgcataagcttcagttgacatatcaattatcaaaaatatattttatgatttgtgtatgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9500271 |
gtattataagttactcgagttgtctgcataagcttcagttgacatatcaattatc-aaaatatattttatgatttgtgtatgt |
9500352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University