View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10740_low_30 (Length: 237)
Name: NF10740_low_30
Description: NF10740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10740_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 2286434 - 2286228
Alignment:
| Q |
4 |
ctagcttccttaataggtattaatccagctatgttctattgtgtgctattaatgtttgatcttatgtgnnnnnnngattaagcactctaagaagagtgtt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
2286434 |
ctagcttccttaataggtattaatccagctatgttctattgtgtgct----------gatcttatgtgtttttttgattaagcactctaaga---gtgtt |
2286348 |
T |
 |
| Q |
104 |
acatcaaatcaaacagctgtctaattgttcacatgtgaagatttggcaatggacctaaagataattaatctagggatagtgtgtttggactgacataagt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2286347 |
acatcaaatcaaacagctgtctaattgttcacatgtgaagatttggcaatggatctaaagataattaatctagggatagtgtgtttggactgacataagt |
2286248 |
T |
 |
| Q |
204 |
atagaccaaatggttggttg |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2286247 |
atagaccaaatggttggttg |
2286228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University